RNU6B

TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers. 
No. Size Price Qty
TTH-RNU6B 50 rxns. $250.00
TTH-RNU6B 250 rxns $850.00
The price does not include shipping fee and tax. ORDER
Features
  • Comprehensive: quantitate only mature miRNAs, not precursors
  • Sensitive: sequence-specific primers
  • ​Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours


Assay information
miRBase Accession Number
NR_004394.1
Chromosome Location
chr15:67839940-67840045
Mature miRNA Sequence:
GTGCTCGCTTCGGCAGCACATATACTAAAATT
GGAACGATACAGAGAAGATTAGCATGGCCC
CTGCGCAAGGATGACACGCAAATTCGTGAA
GCGTTCCATATTTTT
Species:
Human
Assay System:
Probe-base qPCR assay
 


Design of TOOLS miRNA RT-qPCR assay system
Product name miRNA ACC
hsa-let-7a-5p MIMAT0000099
hsa-let-7b-5p MIMAT0000063
hsa-let-7c-5p MIMAT0000064
hsa-let-7d-3p MIMAT0000433
hsa-let-7d-5p MIMAT0000065
hsa-let-7f-5p MIMAT0000067
hsa-let-7g-5p MIMAT0000414
hsa-let-7i-3p MIMAT0004585
hsa-miR-1-3p MIMAT0000416
hsa-miR-9-5p MIMAT0000441
hsa-miR-9-3p MIMAT0000442
hsa-miR-10a-3p MIMAT0004555
hsa-miR-10a-5p MIMAT0000253
hsa-miR-10b-3p MIMAT0004556
hsa-miR-10b-5p MIMAT0000254
hsa-miR-15b-3p MIMAT0004586
hsa-miR-15a-5p MIMAT0000068
hsa-miR-15b-5p MIMAT0000417
hsa-miR-16-5p MIMAT0000069
hsa-miR-17-3p MIMAT0000071
hsa-miR-17-5p MIMAT0000070
hsa-miR-18a-5p MIMAT0000072
hsa-miR-18b-5p MIMAT0001412
hsa-miR-19a-3p MIMAT0000073
hsa-miR-19b-3p MIMAT0000074
hsa-miR-20a-5p MIMAT0000075
hsa-miR-21-5p MIMAT0000076
hsa-miR-22-3p MIMAT0000077
hsa-miR-22-5p MIMAT0004495
hsa-miR-23a-3p MIMAT0000078
hsa-miR-23c MIMAT0018000
hsa-miR-24-1-5p MIMAT0000079
hsa-miR-24-3p MIMAT0000080
hsa-miR-25-3p MIMAT0000081
hsa-miR-25-5p MIMAT0004498
hsa-miR-26a-5p MIMAT0000082
hsa-miR-26b-5p MIMAT0000083
hsa-miR-26a-1-3p MIMAT0004499
hsa-miR-26a-2-3p MIMAT0004681
hsa-miR-27a-3p MIMAT0000084
hsa-miR-27b-3p MIMAT0000419
hsa-miR-29a-3p MIMAT0000086
hsa-miR-29a-5p MIMAT0004503
hsa-miR-29b-2-5p MIMAT0004515
hsa-miR-29b-3p MIMAT0000100
hsa-miR-30a-3p MIMAT0000088
hsa-miR-30a-5p MIMAT0000087
hsa-miR-30b-5p MIMAT0000420
hsa-miR-30c-5p MIMAT0000244
hsa-miR-30d-5p MIMAT0000245
hsa-miR-30e-5p MIMAT0000692
hsa-miR-30e-3p MIMAT0000693
hsa-miR-31-5p MIMAT0000089
hsa-miR-32-5p MIMAT0000090
hsa-miR-33a-5p MIMAT0000091
hsa-miR-34a-5p MIMAT0000255
hsa-miR-34c-5p MIMAT0000686
hsa-miR-92a-3p MIMAT0000092
hsa-miR-92b-3p MIMAT0003218
hsa-miR-93-5p MIMAT0000093
hsa-miR-98-5p MIMAT0000096
hsa-miR-99a-5p MIMAT0000097
hsa-miR-99b-5p MIMAT0000689
hsa-miR-100-5p MIMAT0000098
hsa-miR-101-3p MIMAT0000099
hsa-miR-101-5p MIMAT0004513
hsa-miR-103a-3p MIMAT0000101
hsa-miR-106a-5p MIMAT0000103
hsa-miR-106b-3p MIMAT0004672
hsa-miR-106b-5p MIMAT0000680
hsa-miR-107 MIMAT0000104
hsa-miR-122-5p MIMAT0000421
hsa-miR-125a-5p MIMAT0000443
hsa-miR-125b-5p MIMAT0000423
hsa-miR-126-5p MIMAT0000444
hsa-miR-126-3p MIMAT0000445
hsa-miR-127-3p MIMAT0000446
hsa-miR-128-3p MIMAT0000424
hsa-miR-130b-3p MIMAT0000691
hsa-miR-130b-5p MIMAT0004680
hsa-miR-132-3p MIMAT0000426
hsa-miR-133a-3p MIMAT0000427
hsa-mir-133a-5p MIMAT0026478
hsa-miR-133b MIMAT0000770
hsa-miR-135b-5p MIMAT0000758
hsa-miR-135a-3p MIMAT0004595
hsa-miR-135a-5p MIMAT0000428
Product name miRNA ACC
hsa-miR-139-3p MIMAT0004552
hsa-miR-140-3p MIMAT0004597
hsa-miR-141-3p MIMAT0000432
hsa-miR-142-5p MIMAT0000433
hsa-miR-142-3p MIMAT0000434
hsa-miR-143-3p MIMAT0000435
hsa-miR-144-3p MIMAT0000436
hsa-miR-144-3p MIMAT0004600
hsa-miR-145-5p MIMAT0000437
hsa-miR-146a-5p MIMAT0000449
hsa-miR-148a-3p MIMAT0000243
hsa-miR-148a-5p MIMAT0004549
hsa-miR-148b-3p MIMAT0000759
hsa-miR-149-5p MIMAT0000450
hsa-miR-150-5p MIMAT0000451
hsa-miR-151a-3p MIMAT0000757
hsa-miR-181a-3p MIMAT0000270
hsa-miR-181a-5p MIMAT0000256
hsa-miR-181b-5p MIMAT0000257
hsa-miR-182-5p MIMAT0000259
hsa-miR-183-5p MIMAT0000261
hsa-miR-184 MIMAT0000454
hsa-miR-185-5p MIMAT0000455
hsa-miR-186-5p MIMAT0000456
hsa-miR-187-3p MIMAT0000262
hsa-miR-191-5p MIMAT0000440
hsa-miR-192-5p MIMAT0000222
hsa-miR-193a-5p MIMAT0004614
hsa-miR-193b-3p MIMAT0002819
hsa-miR-193b-5p MIMAT0004767
hsa-miR-194-5p MIMAT0000460
hsa-miR-195-5p MIMAT0000461
hsa-miR-196a-5p MIMAT0000226
hsa-miR-196b-5p MIMAT0001080
hsa-miR-197-3p MIMAT0000227
hsa-miR-199a-3p MIMAT0000232
hsa-miR-199b-5p MIMAT0000263
hsa-miR-200a-3p MIMAT0000682
hsa-miR-200c-3p MIMAT0000617
hsa-miR-203a-3p MIMAT0000264
hsa-mir-204-3p MIMAT0022693
hsa-miR-204-5p MIMAT0000265
hsa-miR-205-5p MIMAT0000266
hsa-miR-208a-3p MIMAT0000241
hsa-miR-208b-3p MIMAT0004960
hsa-miR-210-3p MIMAT0000267
hsa-miR-211-5p MIMAT0000268
hsa-miR-212-3p MIMAT0000269
hsa-miR-214-3p MIMAT0000271
hsa-miR-215-5p MIMAT0000272
hsa-miR-218-5p MIMAT0000275
hsa-miR-221-3p MIMAT0000278
hsa-miR-222-3p MIMAT0000279
hsa-miR-223-3p MIMAT0000280
hsa-miR-223-5p MIMAT0004570
hsa-miR-224-5p MIMAT0000281
hsa-miR-296-3p MIMAT0004679
hsa-miR-320a-3p MIMAT0000510
hsa-miR-320d MIMAT0006764
hsa-miR-324-3p MIMAT0000762
hsa-miR-328-3p MIMAT0000752
hsa-miR-330-3p MIMAT0000751
hsa-miR-335-3p MIMAT0004703
hsa-miR-335-5p MIMAT0000765
hsa-miR-338-3p MIMAT0000763
hsa-miR-339-3p MIMAT0004702
hsa-miR-340-5p MIMAT0004692
hsa-miR-342-3p MIMAT0000753
hsa-miR-342-5p MIMAT0004694
hsa-miR-365a-3p MIMAT0000710
hsa-miR-365a-5p MIMAT0009199
hsa-miR-367-3p MIMAT0000719
hsa-miR-374b-5p MIMAT0004955
hsa-miR-375-3p MIMAT0000728
hsa-miR-378a-3p MIMAT0000732
hsa-miR-378a-5p MIMAT0000731
hsa-mir-409-3p MIMAT0001639
hsa-miR-421 MIMAT0003339
hsa-miR-423-3p MIMAT0001340
hsa-miR-423-5p MIMAT0004748
hhsa-miR-425-5p MIMAT0003393
hsa-miR-429 MIMAT0001536
hsa-miR-450a-5p MIMAT0001545
hsa-miR-451a MIMAT0001631
hsa-miR-452-5p MIMAT0001635
hsa-miR-455-3p MIMAT0004784
hsa-miR-455-5p MIMAT0003150
Product name miRNA ACC
hsa-miR-486-3p MIMAT0004762
hsa-miR-489-3p MIMAT0002805
hsa-miR-494-3p MIMAT0002816
hsa-miR-497-5p MIMAT0002820
hsa-miR-499a-5p MIMAT0002870
hsa-miR-500a-3p MIMAT0002871
hsa-miR-501-3p MIMAT0004774
hsa-miR-502-3p MIMAT0004775
hsa-miR-506-3p MIMAT0002878
hsa-miR-508-3p MIMAT0002880
hsa-miR-509-5p MIMAT0004779
hsa-miR-514a-3p MIMAT0002883
hsa-miR-532-5p MIMAT0002888
hsa-miR-548f-5p MIMAT0026739
hsa-miR-548h-5p MIMAT0005928
hsa-miR-548ar-5p MIMAT0022265
hsa-miR-548aj-5p MIMAT0022739
hsa-miR-550a-5p MIMAT0004800
hsa-miR-574-3p MIMAT0003239
hsa-miR-576-5p MIMAT0003241
hsa-miR-582-3p MIMAT0004797
hsa-miR-584-5p MIMAT0003249
hsa-miR-615-3p MIMAT0003283
hsa-miR-619-3p MIMAT0003288
hsa-miR-624-3p MIMAT0004807
hsa-miR-625-3p MIMAT0004808
hsa-miR-625-5p MIMAT0003294
hsa-miR-627-5p MIMAT0003296
hsa-miR-629-5p MIMAT0004810
hsa-miR-633 MIMAT0003303
hsa-miR-640 MIMAT0003310
hsa-miR-644a MIMAT0003314
hsa-miR-663a MIMAT0003326
hsa-miR-664a-3p MIMAT0005949
hsa-miR-664a-5p MIMAT0005948
hsa-miR-671-5p MIMAT0003880
hsa-miR-744-5p MIMAT0004945
hsa-miR-765 MIMAT0003945
hsa-miR-877-5p MIMAT0004949
hsa-miR-888-5p MIMAT0004916
hsa-miR-933 MIMAT0004976
hsa-miR-937-3p MIMAT0004980
hsa-miR-941 MIMAT0004984
hsa-miR-1180-3p MIMAT0005825
hsa-miR-1207-5p MIMAT0005871
hsa-miR-1226-3p MIMAT0005577
hsa-miR-1227-3p MIMAT0005580
hsa-miR-1229-3p MIMAT0005580
hsa-miR-1238-3p MIMAT0005593
hsa-miR-1246 MIMAT0005898
hsa-miR-1247-5p MIMAT0005899
hsa-miR-1276 MIMAT0005930
hsa-miR-1285-3p MIMAT0005876
hsa-miR-1291 MIMAT0005881
hsa-miR-1292-5p MIMAT0005943
hsa-miR-1307-5p MIMAT0022727
hsa-miR-1322 MIMAT0005953
hsa-miR-1909-3p MIMAT0007883
hsa-miR-2110 MIMAT0010133
hsa-miR-3150a-5p MIMAT0019206
hsa-miR-3158-3p MIMAT0015032
hsa-miR-3166 MIMAT0015040
hsa-miR-3198 MIMAT0015083
hsa-miR-3615 MIMAT0017994
hsa-miR-3688-3p MIMAT0018116
hsa-miR-4260 MIMAT0016881
hsa-miR-4301 MIMAT0016850
hsa-miR-4304 MIMAT0016854
hsa-miR-4436b-5p MIMAT0019940
hsa-miR-4454 MIMAT0018976
hsa-miR-4479 MIMAT0019011
hsa-miR-4488 MIMAT0019022
hsa-miR-4732-3p MIMAT0019856
hsa-miR-4755-3p MIMAT0019896
hsa-miR-4772-5p MIMAT0019926
hsa-miR-4793-3p MIMAT0019966
hsa-miR-5684 MIMAT0022473
hsa-miR-5693 MIMAT0022486
hsa-miR-7706 MIMAT0030021
hsa-miR-7974 MIMAT0031177
hsa-miR-12136 MIMAT0049032
cel-miR-238-3p MIMAT0000293
SNORD48 NR_002745.1
SNORD44 NR_002750.2
RNU6B NR_004394.1
cel-miR-39-3p MIMAT0000010
cel-miR-54-3p MIMAT0000025
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250

TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
  • Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required. 
  • Fast:  RT reaction completed only within 15 mins.
  • Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
  • Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template

TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13

This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions.  TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
  • Easy: All-in-one optimized master mix
  • Specific: Premixed with dUTP/UDG anticontamination system
  • High efficiency and stability
  • ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.

EasyPrep miRNA Extraction Kit
Cat#DPT-BE01

EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
  • Efficient: Completed within 1 hr
  • Quality: silica-based system to yield high-purity small RNA product
  • Flexible: Excellent lysis ability for various sample sources

Q1.  There are six sequences as controls for human miRNA assay, and what are the differences and significance among them? How to apply the control within miRNA profiling? 

A:cel-miR-39-3p, cel-miR-238-3p and cel-miR-54-3p are miRNA from Caenorhabditis elegans and would be used as exogenous control [1] or spike-in control. SNORD44, SNORD48, and RNU6B are endogenous controls when profiling human miRNA, and would be used as housekeeping genes [2]

The client could choose SNORD44, SNORD48, and RNU6B as endogenous controls according to the sample types or experiment design. If there is no suitable design of endogenous control, using exogenous control is also applied. When using exogenous control, the  corresponding spike-in RNA should be added into RNA samples before assay. Customized control is the other option and available from TOOLS. 

 

Q2.  In mRNA profiling, the cDNA samples used in qPCR are synthesized simultaneously, and GAPDH is used as the endogenous control for quantification. However, the stem-loop primer RT method of TOOLS is to synthesize the cDNA of each target separately. Does it make sense to use endogenous control for quantification?

A:Since miRNA sequence is much shorter compared to mRNA, and in order to improve the sensitivity and specificity of each miRNA target, the stem-loop RT method is considered a very efficient and excellent method for miRNA quantification. Indeed, each miRNA target including control is separately assayed, but the quantification based on all reactions using the same RNA sample under very same experiment conditions. 

 

Q3. Is there designed and validated control for Mouse and Rat??

A:Not yet. More search and corresponding materials published are needed, and if there is any, the client could order customized synthesis by us.

 
 

Reference

  1. Vigneron, N., et al., Towards a new standardized method for circulating miRNAs profiling in clinical studies: Interest of the exogenous normalization to improve miRNA signature accuracy. 2016. 10(7): p. 981-992.
  2. Donati, S., S. Ciuffi, and M.L.J.I.j.o.m.s. Brandi, Human circulating miRNAs real-time qRT-PCR-based analysis: an overview of endogenous reference genes used for data normalization. 2019. 20(18): p. 4353.