hsa-miR-218-5p
TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers.
Features
Assay information
-
Comprehensive: quantitate only mature miRNAs, not precursors
- Sensitive: sequence-specific primers
- Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours
Assay information
|
miRBase Accession Number
|
MIMAT0000275
|
|
Chromosome Location
|
chr4:20528299-20528319 (+)
chr5:168768211-168768231 (-) |
|
Mature miRNA Sequence:
|
UUGUGCUUGAUCUAACCAUGU
|
|
Species:
|
Human
|
|
Assay System:
|
Probe-base qPCR assay
|
Design of TOOLS miRNA RT-qPCR assay system
.jpg)
| Product name | miRNA ACC |
|---|---|
| hsa-let-7a-5p | MIMAT0000099 |
| hsa-let-7b-5p | MIMAT0000063 |
| hsa-let-7c-5p | MIMAT0000064 |
| hsa-let-7d-3p | MIMAT0000433 |
| hsa-let-7d-5p | MIMAT0000065 |
| hsa-let-7f-5p | MIMAT0000067 |
| hsa-let-7g-5p | MIMAT0000414 |
| hsa-let-7i-3p | MIMAT0004585 |
| hsa-miR-1-3p | MIMAT0000416 |
| hsa-miR-9-5p | MIMAT0000441 |
| hsa-miR-9-3p | MIMAT0000442 |
| hsa-miR-10a-3p | MIMAT0004555 |
| hsa-miR-10a-5p | MIMAT0000253 |
| hsa-miR-10b-3p | MIMAT0004556 |
| hsa-miR-10b-5p | MIMAT0000254 |
| hsa-miR-15b-3p | MIMAT0004586 |
| hsa-miR-15a-5p | MIMAT0000068 |
| hsa-miR-15b-5p | MIMAT0000417 |
| hsa-miR-16-5p | MIMAT0000069 |
| hsa-miR-17-3p | MIMAT0000071 |
| hsa-miR-17-5p | MIMAT0000070 |
| hsa-miR-18a-5p | MIMAT0000072 |
| hsa-miR-18b-5p | MIMAT0001412 |
| hsa-miR-19a-3p | MIMAT0000073 |
| hsa-miR-19b-3p | MIMAT0000074 |
| hsa-miR-20a-5p | MIMAT0000075 |
| hsa-miR-21-5p | MIMAT0000076 |
| hsa-miR-22-3p | MIMAT0000077 |
| hsa-miR-22-5p | MIMAT0004495 |
| hsa-miR-23a-3p | MIMAT0000078 |
| hsa-miR-23c | MIMAT0018000 |
| hsa-miR-24-1-5p | MIMAT0000079 |
| hsa-miR-24-3p | MIMAT0000080 |
| hsa-miR-25-3p | MIMAT0000081 |
| hsa-miR-25-5p | MIMAT0004498 |
| hsa-miR-26a-5p | MIMAT0000082 |
| hsa-miR-26b-5p | MIMAT0000083 |
| hsa-miR-26a-1-3p | MIMAT0004499 |
| hsa-miR-26a-2-3p | MIMAT0004681 |
| hsa-miR-27a-3p | MIMAT0000084 |
| hsa-miR-27b-3p | MIMAT0000419 |
| hsa-miR-29a-3p | MIMAT0000086 |
| hsa-miR-29a-5p | MIMAT0004503 |
| hsa-miR-29b-2-5p | MIMAT0004515 |
| hsa-miR-29b-3p | MIMAT0000100 |
| hsa-miR-30a-3p | MIMAT0000088 |
| hsa-miR-30a-5p | MIMAT0000087 |
| hsa-miR-30b-5p | MIMAT0000420 |
| hsa-miR-30c-5p | MIMAT0000244 |
| hsa-miR-30d-5p | MIMAT0000245 |
| hsa-miR-30e-5p | MIMAT0000692 |
| hsa-miR-30e-3p | MIMAT0000693 |
| hsa-miR-31-5p | MIMAT0000089 |
| hsa-miR-32-5p | MIMAT0000090 |
| hsa-miR-33a-5p | MIMAT0000091 |
| hsa-miR-34a-5p | MIMAT0000255 |
| hsa-miR-34c-5p | MIMAT0000686 |
| hsa-miR-92a-3p | MIMAT0000092 |
| hsa-miR-92b-3p | MIMAT0003218 |
| hsa-miR-93-5p | MIMAT0000093 |
| hsa-miR-98-5p | MIMAT0000096 |
| hsa-miR-99a-5p | MIMAT0000097 |
| hsa-miR-99b-5p | MIMAT0000689 |
| hsa-miR-100-5p | MIMAT0000098 |
| hsa-miR-101-3p | MIMAT0000099 |
| hsa-miR-101-5p | MIMAT0004513 |
| hsa-miR-103a-3p | MIMAT0000101 |
| hsa-miR-106a-5p | MIMAT0000103 |
| hsa-miR-106b-3p | MIMAT0004672 |
| hsa-miR-106b-5p | MIMAT0000680 |
| hsa-miR-107 | MIMAT0000104 |
| hsa-miR-122-5p | MIMAT0000421 |
| hsa-miR-125a-5p | MIMAT0000443 |
| hsa-miR-125b-5p | MIMAT0000423 |
| hsa-miR-126-5p | MIMAT0000444 |
| hsa-miR-126-3p | MIMAT0000445 |
| hsa-miR-127-3p | MIMAT0000446 |
| hsa-miR-128-3p | MIMAT0000424 |
| hsa-miR-130b-3p | MIMAT0000691 |
| hsa-miR-130b-5p | MIMAT0004680 |
| hsa-miR-132-3p | MIMAT0000426 |
| hsa-miR-133a-3p | MIMAT0000427 |
| hsa-mir-133a-5p | MIMAT0026478 |
| hsa-miR-133b | MIMAT0000770 |
| hsa-miR-135b-5p | MIMAT0000758 |
| hsa-miR-135a-3p | MIMAT0004595 |
| hsa-miR-135a-5p | MIMAT0000428 |
| Product name | miRNA ACC |
|---|---|
| hsa-miR-139-3p | MIMAT0004552 |
| hsa-miR-140-3p | MIMAT0004597 |
| hsa-miR-141-3p | MIMAT0000432 |
| hsa-miR-142-5p | MIMAT0000433 |
| hsa-miR-142-3p | MIMAT0000434 |
| hsa-miR-143-3p | MIMAT0000435 |
| hsa-miR-144-3p | MIMAT0000436 |
| hsa-miR-144-3p | MIMAT0004600 |
| hsa-miR-145-5p | MIMAT0000437 |
| hsa-miR-146a-5p | MIMAT0000449 |
| hsa-miR-148a-3p | MIMAT0000243 |
| hsa-miR-148a-5p | MIMAT0004549 |
| hsa-miR-148b-3p | MIMAT0000759 |
| hsa-miR-149-5p | MIMAT0000450 |
| hsa-miR-150-5p | MIMAT0000451 |
| hsa-miR-151a-3p | MIMAT0000757 |
| hsa-miR-181a-3p | MIMAT0000270 |
| hsa-miR-181a-5p | MIMAT0000256 |
| hsa-miR-181b-5p | MIMAT0000257 |
| hsa-miR-182-5p | MIMAT0000259 |
| hsa-miR-183-5p | MIMAT0000261 |
| hsa-miR-184 | MIMAT0000454 |
| hsa-miR-185-5p | MIMAT0000455 |
| hsa-miR-186-5p | MIMAT0000456 |
| hsa-miR-187-3p | MIMAT0000262 |
| hsa-miR-191-5p | MIMAT0000440 |
| hsa-miR-192-5p | MIMAT0000222 |
| hsa-miR-193a-5p | MIMAT0004614 |
| hsa-miR-193b-3p | MIMAT0002819 |
| hsa-miR-193b-5p | MIMAT0004767 |
| hsa-miR-194-5p | MIMAT0000460 |
| hsa-miR-195-5p | MIMAT0000461 |
| hsa-miR-196a-5p | MIMAT0000226 |
| hsa-miR-196b-5p | MIMAT0001080 |
| hsa-miR-197-3p | MIMAT0000227 |
| hsa-miR-199a-3p | MIMAT0000232 |
| hsa-miR-199b-5p | MIMAT0000263 |
| hsa-miR-200a-3p | MIMAT0000682 |
| hsa-miR-200c-3p | MIMAT0000617 |
| hsa-miR-203a-3p | MIMAT0000264 |
| hsa-mir-204-3p | MIMAT0022693 |
| hsa-miR-204-5p | MIMAT0000265 |
| hsa-miR-205-5p | MIMAT0000266 |
| hsa-miR-208a-3p | MIMAT0000241 |
| hsa-miR-208b-3p | MIMAT0004960 |
| hsa-miR-210-3p | MIMAT0000267 |
| hsa-miR-211-5p | MIMAT0000268 |
| hsa-miR-212-3p | MIMAT0000269 |
| hsa-miR-214-3p | MIMAT0000271 |
| hsa-miR-215-5p | MIMAT0000272 |
| hsa-miR-218-5p | MIMAT0000275 |
| hsa-miR-221-3p | MIMAT0000278 |
| hsa-miR-222-3p | MIMAT0000279 |
| hsa-miR-223-3p | MIMAT0000280 |
| hsa-miR-223-5p | MIMAT0004570 |
| hsa-miR-224-5p | MIMAT0000281 |
| hsa-miR-296-3p | MIMAT0004679 |
| hsa-miR-320a-3p | MIMAT0000510 |
| hsa-miR-320d | MIMAT0006764 |
| hsa-miR-324-3p | MIMAT0000762 |
| hsa-miR-328-3p | MIMAT0000752 |
| hsa-miR-330-3p | MIMAT0000751 |
| hsa-miR-335-3p | MIMAT0004703 |
| hsa-miR-335-5p | MIMAT0000765 |
| hsa-miR-338-3p | MIMAT0000763 |
| hsa-miR-339-3p | MIMAT0004702 |
| hsa-miR-340-5p | MIMAT0004692 |
| hsa-miR-342-3p | MIMAT0000753 |
| hsa-miR-342-5p | MIMAT0004694 |
| hsa-miR-365a-3p | MIMAT0000710 |
| hsa-miR-365a-5p | MIMAT0009199 |
| hsa-miR-367-3p | MIMAT0000719 |
| hsa-miR-374b-5p | MIMAT0004955 |
| hsa-miR-375-3p | MIMAT0000728 |
| hsa-miR-378a-3p | MIMAT0000732 |
| hsa-miR-378a-5p | MIMAT0000731 |
| hsa-mir-409-3p | MIMAT0001639 |
| hsa-miR-421 | MIMAT0003339 |
| hsa-miR-423-3p | MIMAT0001340 |
| hsa-miR-423-5p | MIMAT0004748 |
| hhsa-miR-425-5p | MIMAT0003393 |
| hsa-miR-429 | MIMAT0001536 |
| hsa-miR-450a-5p | MIMAT0001545 |
| hsa-miR-451a | MIMAT0001631 |
| hsa-miR-452-5p | MIMAT0001635 |
| hsa-miR-455-3p | MIMAT0004784 |
| hsa-miR-455-5p | MIMAT0003150 |
| Product name | miRNA ACC |
|---|---|
| hsa-miR-486-3p | MIMAT0004762 |
| hsa-miR-489-3p | MIMAT0002805 |
| hsa-miR-494-3p | MIMAT0002816 |
| hsa-miR-497-5p | MIMAT0002820 |
| hsa-miR-499a-5p | MIMAT0002870 |
| hsa-miR-500a-3p | MIMAT0002871 |
| hsa-miR-501-3p | MIMAT0004774 |
| hsa-miR-502-3p | MIMAT0004775 |
| hsa-miR-506-3p | MIMAT0002878 |
| hsa-miR-508-3p | MIMAT0002880 |
| hsa-miR-509-5p | MIMAT0004779 |
| hsa-miR-514a-3p | MIMAT0002883 |
| hsa-miR-532-5p | MIMAT0002888 |
| hsa-miR-548f-5p | MIMAT0026739 |
| hsa-miR-548h-5p | MIMAT0005928 |
| hsa-miR-548ar-5p | MIMAT0022265 |
| hsa-miR-548aj-5p | MIMAT0022739 |
| hsa-miR-550a-5p | MIMAT0004800 |
| hsa-miR-574-3p | MIMAT0003239 |
| hsa-miR-576-5p | MIMAT0003241 |
| hsa-miR-582-3p | MIMAT0004797 |
| hsa-miR-584-5p | MIMAT0003249 |
| hsa-miR-615-3p | MIMAT0003283 |
| hsa-miR-619-3p | MIMAT0003288 |
| hsa-miR-624-3p | MIMAT0004807 |
| hsa-miR-625-3p | MIMAT0004808 |
| hsa-miR-625-5p | MIMAT0003294 |
| hsa-miR-627-5p | MIMAT0003296 |
| hsa-miR-629-5p | MIMAT0004810 |
| hsa-miR-633 | MIMAT0003303 |
| hsa-miR-640 | MIMAT0003310 |
| hsa-miR-644a | MIMAT0003314 |
| hsa-miR-663a | MIMAT0003326 |
| hsa-miR-664a-3p | MIMAT0005949 |
| hsa-miR-664a-5p | MIMAT0005948 |
| hsa-miR-671-5p | MIMAT0003880 |
| hsa-miR-744-5p | MIMAT0004945 |
| hsa-miR-765 | MIMAT0003945 |
| hsa-miR-877-5p | MIMAT0004949 |
| hsa-miR-888-5p | MIMAT0004916 |
| hsa-miR-933 | MIMAT0004976 |
| hsa-miR-937-3p | MIMAT0004980 |
| hsa-miR-941 | MIMAT0004984 |
| hsa-miR-1180-3p | MIMAT0005825 |
| hsa-miR-1207-5p | MIMAT0005871 |
| hsa-miR-1226-3p | MIMAT0005577 |
| hsa-miR-1227-3p | MIMAT0005580 |
| hsa-miR-1229-3p | MIMAT0005580 |
| hsa-miR-1238-3p | MIMAT0005593 |
| hsa-miR-1246 | MIMAT0005898 |
| hsa-miR-1247-5p | MIMAT0005899 |
| hsa-miR-1276 | MIMAT0005930 |
| hsa-miR-1285-3p | MIMAT0005876 |
| hsa-miR-1291 | MIMAT0005881 |
| hsa-miR-1292-5p | MIMAT0005943 |
| hsa-miR-1307-5p | MIMAT0022727 |
| hsa-miR-1322 | MIMAT0005953 |
| hsa-miR-1909-3p | MIMAT0007883 |
| hsa-miR-2110 | MIMAT0010133 |
| hsa-miR-3150a-5p | MIMAT0019206 |
| hsa-miR-3158-3p | MIMAT0015032 |
| hsa-miR-3166 | MIMAT0015040 |
| hsa-miR-3198 | MIMAT0015083 |
| hsa-miR-3615 | MIMAT0017994 |
| hsa-miR-3688-3p | MIMAT0018116 |
| hsa-miR-4260 | MIMAT0016881 |
| hsa-miR-4301 | MIMAT0016850 |
| hsa-miR-4304 | MIMAT0016854 |
| hsa-miR-4436b-5p | MIMAT0019940 |
| hsa-miR-4454 | MIMAT0018976 |
| hsa-miR-4479 | MIMAT0019011 |
| hsa-miR-4488 | MIMAT0019022 |
| hsa-miR-4732-3p | MIMAT0019856 |
| hsa-miR-4755-3p | MIMAT0019896 |
| hsa-miR-4772-5p | MIMAT0019926 |
| hsa-miR-4793-3p | MIMAT0019966 |
| hsa-miR-5684 | MIMAT0022473 |
| hsa-miR-5693 | MIMAT0022486 |
| hsa-miR-7706 | MIMAT0030021 |
| hsa-miR-7974 | MIMAT0031177 |
| hsa-miR-12136 | MIMAT0049032 |
| cel-miR-238-3p | MIMAT0000293 |
| SNORD48 | NR_002745.1 |
| SNORD44 | NR_002750.2 |
| RNU6B | NR_004394.1 |
| cel-miR-39-3p | MIMAT0000010 |
| cel-miR-54-3p | MIMAT0000025 |
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
-
Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required.
-
Fast: RT reaction completed only within 15 mins.
-
Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
-
Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template
TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
-
Easy: All-in-one optimized master mix
-
Specific: Premixed with dUTP/UDG anticontamination system
-
High efficiency and stability
-
ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.
EasyPrep miRNA Extraction Kit
Cat#DPT-BE01
EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
- Efficient: Completed within 1 hr
- Quality: silica-based system to yield high-purity small RNA product
- Flexible: Excellent lysis ability for various sample sources
Breast Cancer
- Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.Taipaleenmäki, Hanna, et al. "Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells." Oncotarget 7.48 (2016): 79032.
- Xia, Chen, et al. "The multifunction of miR-218-5p-Cx43 axis in breast cancer." OncoTargets and therapy 12 (2019): 8319.
- Setijono, Stephanie Rebecca, et al. "miR-218 and miR-129 regulate breast cancer progression by targeting Lamins." Biochemical and biophysical research communications 496.3 (2018): 826-833.
Colorectal Cancer
- Liu, Minghui, et al. "Diphthamide biosynthesis 1 is a novel oncogene in colorectal cancer cells and is regulated by MiR-218-5p." Cellular Physiology and Biochemistry 44.2 (2017): 505-514.
- Li, Jian, et al. "MicroRNA expression profiling in the colorectal normal‑adenoma‑carcinoma transition." Oncology letters 18.2 (2019): 2013-2018.
- Gu, Chao, et al. "Long non‑coding RNA CCAT1 promotes colorectal cancer cell migration, invasiveness and viability by upregulating VEGF via negative modulation of microRNA‑218." Experimental and therapeutic medicine 19.4 (2020): 2543-2550.
- Ilm, Katharina, et al. "MACC1 is post-transcriptionally regulated by miR-218 in colorectal cancer." Oncotarget 7.33 (2016): 53443.
Parkinson Disease
- Ma, Xuelian, et al. "Up-regulated microRNA-218-5p ameliorates the damage of dopaminergic neurons in rats with Parkinson’s disease via suppression of LASP1." Brain Research Bulletin 166 (2021): 92-101.