hsa-miR-4484

TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers. 
No. Size Price Qty
TTH-4484 50 rxns. $250.00
TTH-4484 250 rxns $850.00
The price does not include shipping fee and tax. ORDER
Features
  • Comprehensive: quantitate only mature miRNAs, not precursors
  • Sensitive: sequence-specific primers
  • ​Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours


Assay information
miRBase Accession Number MIMAT0019018
Chromosome Location -
Mature miRNA Sequence:
AAAAGGCGGGAGAAGCCCCA
Species: Human
Assay System: Probe-base qPCR assay
 


Design of TOOLS miRNA RT-qPCR assay system
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250

TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
  • Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required. 
  • Fast:  RT reaction completed only within 15 mins.
  • Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
  • Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template

TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13

This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions.  TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
  • Easy: All-in-one optimized master mix
  • Specific: Premixed with dUTP/UDG anticontamination system
  • High efficiency and stability
  • ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.

EasyPrep miRNA Extraction Kit
Cat#DPT-BE01

EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
  • Efficient: Completed within 1 hr
  • Quality: silica-based system to yield high-purity small RNA product
  • Flexible: Excellent lysis ability for various sample sources
Breast Cancer
  • Behzad, Mansoori, et al. "Micro RNA 34a and Let-7a expression in human breast cancers is associated with apoptotic expression genes." Asian Pacific Journal of Cancer Prevention 17.4 (2016): 1887-1890.
  • Chen, Changguo, et al. "Clinical significance of let-7a-5p and miR-21-5p in patients with breast cancer." Annals of Clinical & Laboratory Science 49.3 (2019): 302-308.
  • Yang, Weiping, et al. "Circ-ABCB10 contributes to paclitaxel resistance in breast cancer through Let-7a-5p/DUSP7 axis." Cancer management and research 12 (2020): 2327.
  • Yao, Ao, et al. "PKM2 promotes glucose metabolism through a let‐7a‐5p/Stat3/hnRNP‐A1 regulatory feedback loop in breast cancer cells." Journal of cellular biochemistry 120.4 (2019): 6542-6554.

Colorectal Cancer
  • Ghanbari, Reza, et al. "Simultaneous Underexpression of let-7a-5p and let-7f-5p microRNAs in Plasma and Stool Samples from Early Stage Colorectal Carcinoma: Supplementary Issue: Biomarkers for Colon Cancer." Biomarkers in cancer 7 (2015): BIC-S25252.
  • Conde, Elisa, et al. "Novel molecular characterization of colorectal primary tumors based on miRNAs." Cancers 11.3 (2019): 346.
  • Liu, Tsang-Pai, et al. "Down-regulation of let-7a-5p predicts lymph node metastasis and prognosis in colorectal cancer: Implications for chemotherapy." Surgical oncology 25.4 (2016): 429-434.
  • Bahnassy, Abeer A., et al. "MiRNAs as molecular biomarkers in stage II egyptian colorectal cancer patients." Experimental and molecular pathology 105.3 (2018): 260-271.